Loading... Please wait...

Fungal/Yeast ITS PCR Primers for identification and barcoding

Roll over to magnify and click to enlarge
  • Image 1

Product Reviews

Write Review

This product hasn't received any reviews yet. Be the first to review this product!

$10.00
Shipping:
Calculated at checkout

Product Description

We will send you a primer mix for 100 PCR reactions for the fungal ITS1F and ITS4R primers. These primers can be used to amplify the Intergenic Spacer Region in Fungal DNA for use in identification.

 

 

ITS1F

TCCGTAGGTGAACCTGCGG

 

ITS4R

TCCTCCGCTTATTGATATGC

 

More information can be found in White et al. 1990 Here