- Home
- All Products
- Fungal/Yeast ITS PCR Primers for identification and barcoding
- Home
- Yeast & Brewing
- Fungal/Yeast ITS PCR Primers for identification and barcoding
Fungal/Yeast ITS PCR Primers for identification and barcoding
$10.00
Product Description
We will send you a primer mix for 100 PCR reactions for the fungal ITS1F and ITS4R primers. These primers can be used to amplify the Intergenic Spacer Region in Fungal DNA for use in identification.
ITS1F
TCCGTAGGTGAACCTGCGG
ITS4R
TCCTCCGCTTATTGATATGC
More information can be found in White et al. 1990 Here