Loading... Please wait...

Bacterial 16s rDNA primers for Bacterial identification

Roll over to magnify and click to enlarge
  • Image 1

Product Reviews

Write Review

This product hasn't received any reviews yet. Be the first to review this product!

$20.00
Shipping:
Calculated at checkout

Product Description

Looking to do some microbiome analysis but don't have the money to drop on metagenomics?

This includes all the primers you will need to PCR and sequence the 16s rDNA of bacteria that you want to identify. Each primer will include enough for 100 PCR or sequencing reactions.

 

See a 16s rDNA PCR tutorial for bacterial identification HERE

 

 

Primers included (F)orward and (R)everse:

8F

AGAGTTTGATCCTGGCTCAG

 

515F

GTGCCAGCMGCCGCGGTAA

 

1492R

GGTTACCTTGTTACGACTT